BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Dcitr_OGSv2.0_rna.fa 25,292 sequences; 49,157,538 total letters Query= Untitled_sequence Length=954 Score E Sequences producing significant alignments: (Bits) Value DcitrM078875.1.1Globin D, coelomic, putative (AHRD V3.11 *-* tr|E... 69.4 6e-11 >DcitrM078875.1.1 Globin D, coelomic, putative (AHRD V3.11 *-* tr|E0VN13|E0VN13_PEDHC). AED 0.33 Length=2312 Score = 69.4 bits (37), Expect = 6e-11 Identities = 37/37 (100%), Gaps = 0/37 (0%) Strand=Plus/Minus Query 791 GAAAGTCATTTCTCGATTGCCTAATTCAAGGAACATC 827 ||||||||||||||||||||||||||||||||||||| Sbjct 348 GAAAGTCATTTCTCGATTGCCTAATTCAAGGAACATC 312 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 45079946102 Database: Dcitr_OGSv2.0_rna.fa Posted date: Mar 4, 2018 10:37 PM Number of letters in database: 49,157,538 Number of sequences in database: 25,292 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5