BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Dcitr_OGSv2.0_rna.fa 25,292 sequences; 49,157,538 total letters Query= Untitled_sequence Length=600 Score E Sequences producing significant alignments: (Bits) Value DcitrM083525.1.1U3 small nucleolar RNA-associated protein 14-like... 117 1e-25 >DcitrM083525.1.1 U3 small nucleolar RNA-associated protein 14-like protein A (AHRD V3.11 *-* tr|A0A067RJT3|A0A067RJT3_ZOONE). Similar to MCOT18967.0.CO. AED 0.17 Length=2117 Score = 117 bits (63), Expect = 1e-25 Identities = 73/78 (94%), Gaps = 0/78 (0%) Strand=Plus/Minus Query 45 CTTTGAGGGTTTCAGTTTTCAATTTAGTTTAGGGCTATGGGGGAAATGTATTTCCTAAAC 104 |||||||||||||||||||||||||||||||| |||||| | || ||||||||||||||| Sbjct 78 CTTTGAGGGTTTCAGTTTTCAATTTAGTTTAGTGCTATGTGTGAGATGTATTTCCTAAAC 19 Query 105 TTGTTCTATTTAAATTTA 122 |||||||||||| ||||| Sbjct 18 TTGTTCTATTTAGATTTA 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 27902011850 Database: Dcitr_OGSv2.0_rna.fa Posted date: Mar 4, 2018 10:37 PM Number of letters in database: 49,157,538 Number of sequences in database: 25,292 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5