BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Cclementina_182_v1.0.cds_primaryTranscriptOnly_annot.fasta 24,533 sequences; 30,654,468 total letters Query= Cs1g01030.1 Length=261 Score E Sequences producing significant alignments: (Bits) Value Ciclev10017785mterpene synthase-like sequence-1,8-cineole, simila... 106 7e-23 >Ciclev10017785m terpene synthase-like sequence-1,8-cineole, similar to AT3G25820.1 Length=1746 Score = 106 bits (57), Expect = 7e-23 Identities = 89/105 (85%), Gaps = 0/105 (0%) Strand=Plus/Plus Query 109 TATATGCAGATTTGCTATTTGGCTATGTTCAACTTTGGAAATGACTTGGCATATTATGAT 168 ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||| | ||| | Sbjct 1075 TATATGCAGATTTGCTACTTGGCCATGTTTAACTTTGGAAATGAGTTGGCATGTGATGTT 1134 Query 169 CTCAAAATTCATGGCCTGAATTTGCTGTCCAACATTAAGAATGAG 213 | |||||||||||||| ||| || ||| |||||||||| ||| Sbjct 1135 ATGAAAATTCATGGCCTCAATACTCTATCCTACATTAAGAAAGAG 1179 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 7161469742 Database: Cclementina_182_v1.0.cds_primaryTranscriptOnly_annot.fasta Posted date: Jul 14, 2015 1:42 PM Number of letters in database: 30,654,468 Number of sequences in database: 24,533 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5