BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Dcitr_OGSv2.0_cds.fa 25,292 sequences; 34,155,564 total letters Query= 132465 Length=1000 Score E Sequences producing significant alignments: (Bits) Value DcitrC063805.1.1facilitated trehalose transporter Tret1-like (AHR... 84.2 1e-15 >DcitrC063805.1.1 facilitated trehalose transporter Tret1-like (AHRD V3.11 *-* tr|A0A1W4WVK3|A0A1W4WVK3_AGRPL). AED 0.09| InterPro:IPR005828,Pfam:PF00083| GO:0016021,GO:0022857,GO:0055085 Length=531 Score = 84.2 bits (45), Expect = 1e-15 Identities = 64/73 (88%), Gaps = 1/73 (1%) Strand=Plus/Plus Query 266 ATTTATACTGCTAGAATAGGTCTGAAGAGT-CCTTTTTTCCAGCAGTAGGCTACTGCTAT 324 |||||||||||| | ||||| ||||| ||| ||||| ||||||||||||||||| |||| Sbjct 442 ATTTATACTGCTCGCATAGGACTGAAAAGTCCCTTTACTCCAGCAGTAGGCTACTACTAT 501 Query 325 TATTCTGGTCAAA 337 |||| |||||||| Sbjct 502 TATTGTGGTCAAA 514 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 32685182400 Database: Dcitr_OGSv2.0_cds.fa Posted date: Mar 4, 2018 10:37 PM Number of letters in database: 34,155,564 Number of sequences in database: 25,292 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5